Introduction
Antibodies play a crucial role in protecting the human body from viral infection. But there is doubt of the therapeutic potential of rodent antibodies in humans owing to the immune response they elicit.[1,2] Fortunately, recent advances in using antibody phage-display have made it possible to get completely humanized antibodies, among which the single-chain antibody (ScFv) is particularly useful.[3,4]
The major humoral immune response to hepatitis B virus (HBV) is mounted against HBsAg, which is composed of 3 related membrane-bound proteins:[5-7] S (226aa), PreS2 (55aa) and PreS1 (108aa). The results of clinical research have shown that the antibody specific to PreS1 may neutralize HBV and disturb its replication.[8]
Keeping these in mind, we initiated this project to get completely humanized ScFv against PreS1, which would provide a more satisfactory therapy of hepatitis B. It is more likely that the high affinity ScFv can be obtained from the immune library other than from naive one[9-13] because the irrelevant antibodies may be removed by immune response, followed by the improvement of the V-gene before cloning.[14] Hence, we used the method of in vitro antigen stimulation to obtain immune B cells of an immune source. The result proved that it is powerful to isolate human ScFv of interest.
Methods
Immunization and lymphocyte RNA preparation
Each of 6 healthy volunteers donated 5 ml of PBLs, from which 1¡Á108 lymphocytes were obtained after density-gradient separation. The cells were cultured in the presence of 100 ¦Ìg/ml BSA-PreS1 (gift of Mr. R Vinas, Pasteur Merieux, USA) covering amino acids P20-47 of HBV for 5 days in a RPMI 1640 medium with 10% human AB serum and 1% PHA. Then RNA was isolated by Trizol reagent (Gibico-BRL), dryed and stored at -70 ¡æ till use for reverse transcription.
Amplification and assembling of the VH and VL genes
cDNA synthesis was performed by RT-PCR kit (Takara, Dalian, China). PCR amplification was carried out using Pyrobest DNA polymerase with GC buffer kit in 50 ¦Ìl reaction mixture (Takara, Dalian, China). Primers used for PCR amplification of human heavy and light chain V-genes are shown in Table 1. To maintain a maximal diversity, half-nest PCR was employed.[15] IgM-derived heavy chain genes (VH+CH1) were amplified by a primary PCR with an IgM constant region primer (forward primer) and separate 5 VH primers (reverse primers). Then the products were reamplified with JH primer (forward primer) annealing to 3¡¯ end of VH and the VH primers described above. All the primers were designed according to V-BASE.[16] The PCR condition was adjusted at 94 ¡æ 1 min (98 ¡æ for 10 s, 52 ¡æ for 30 s, and 72 ¡æ for 30 s)¡Á30 rounds. The PCR products were purified by a PCR fragment recovery kit (Takara, Dalian, China). The light chain V-genes of the ¦Ê and ¦Ë families were amplified by the PCR described above.
To connect the VH and VL genes, an oligonucletide coding for the (G4S)3 linker was used. Firstly, the template of linker was synthesized (GGTGGAGGCGGTTCAGGCGGAGGT GGCTCTGGCGGTGGCGGAAGT). It was amplified subsequently by 6 groups of primers annealing to 3¡¯ end of VH and 5¡¯ end of VL (V¦Ê and V¦Ë) separately (Table 2). After PCR, 6 linker fragments which are hybrids to 3¡¯ end of VH and 5¡¯ end of 6 VL genes separately were obtained. PCR products were purified.
To join the VH, VL and linker fragment, splicing overlap extension PCR was performed. The equimolar of 3 fragments was mixed, cycled 7 rounds (98 ¡æ for 10 s, 58 ¡æ for 30 s, and 72 ¡æ for 30 s) to join the fragments before amplification for 30 cycles (98 ¡æ for 10 s, 55 ¡æ for 30 s, and 72 ¡æ for 30 s) after the addition of outer primers. VH-linker-VL (ScFv) gene fragments were purified as mentioned above.


Library construction
After the ScFv genes were digested with Sfi I and Not I restriction enzyme, they were cloned into pCANTAB5E phagemid vector (Phamarcia) digested with the same restriction enzyme. Following 10 electroporations into E.coli TG1, the library was titered as described previously[14] and stored at -70 ¡æ.
Library panning
Phagemid population was rescued from the library as reported.[17] Specific phage-displayed ScFv was affinity-selected via protein absorbed to an immuno tube (Gibco). Firstly the tube was coated overnight by PreS1 (100 ¦Ìg/ml) at 4 ¡æ and washed next day with phosphate buffered saline (PBS) and blocked with 3% BSA-PBS (contain 3% bovine serum persulfate). To deplete the libraries of casein antibodies, rescued phagemid population was preincubated with 3% BSA-PBS before being poured into a prepared tube. After incubation for 1 hour at room temperature, the tube was emptied and washed with 0.05% PBST (contain 0.05% tween-20) for 20 times, then with PBS for another 20 times before Log-phase TG1 cells were added and incubated at 37 ¡æ for 1 hour to allow reinfection. The output phage titer was quantitated. The panning was repeated thrice.
Monoclonal ELISA
After the third panning, 96 clones of the library were inoculated into a 96-well plate. Phage population was rescued from every clone.[17] 100 ¦Ìl supernatant containing phage was added into another 96-well plate coated with 100 ¦Ìl (10 ¦Ìg/ml) PreS1 overnight at 4 ¡æ and blocked with 2% MPBS (2% no fat milk BSA). Incubated at room temperature for 2 hours, then 100 ¦Ìl HRP-antiM13 antibody was added into each well. After incubation for 1 hour, the plate was washed with 0.05% PBST for 5 times, then ABTS was added. Thirty minutes incubation at room temperature was needed before the measurement of the absorbance of each well at 410 nm with an enzyme-linked immunosorbent assay reader. Positive clones were tested using cross reaction with BSA.
Fingerprinting assay
The positive clones were assayed by restriction enzyme Afa I and Hha I.[18]
Preparation of soluble ScFv
The positive clones identified by ELISA were inoculated into 400 ¦Ìl log phase E.coli HB2151.After shaking at 37 ¡æ for 30 minutes, the culture was plated on a SOBAG-N medium. Next day, the individual colonies were inoculated into 5 ml 2YT-AG for overnight shaking at 30 ¡æ. After centrifugation at 1800 g for 10 minutes, the pellet was resuspended in 50 ml 2YT-AI containing 1 mmol IPTG and shakened for 6 hours at 30 ¡æ. After centrifugation at 2000 g for 20 minutes, the pellet was resuspended in TEX buffer (0.5 mmol sucrose, 0.5 mmol EDTA) on ice for 60 minutes. Periplasmic fractions containing soluble ScFv were prepared by the above centrifugation.
Competitive ELISA
To determine the affinity, competition ELISA was performed to measure the binding constants of ScFv. Briefly, a 96-well plate was coated and blocked. Periplasmic fractions containing ScFv were incubated with serially diluted buffer containing free PreS1 overnight at 4 ¡æ to allow equilibration. After the plate was washed, ScFv-PreS1 mixture was added, then analyzed by ELISA.
Sequencing
Plasmids of the specific phage antibody described above were prepared for sequencing in Takara Co., Ltd., Dalian, China.
Results
Immunization in vitro
1¡Á108 lymphocytes were cultured in the presence of PreS1 (100 ¦Ìg/ml). After 5 days, the cells proliferated to 2¡Á108.
Library construction
After half-nest PCR, 5 IgM derived VH, 6 V¦Ê and 3 V¦Ë fragments were obtained. Subsequently, 6 linkers bridged between VH, V¦Ê and V¦Ë were also amplified, resulting in the accomplishment of 45 ScFv fragments. From these products, 10 electroporations showed in 7¡Á108 immune phage-display library.
Library panning
The specific phage antibodies were enriched evidently by the increase of the number of clones from the first panning to the third panning (Table 2).
ELISA
The phage population rescued from the third panning was subjected to ELISA with PreS1. The results showed that the frequency of positive clone was 55/94, whereas the bacterial supernatant containing negative clones as judged by the phage screening assay showed no reactivity with PreS1 in ELISA. No cross reaction toward BSA was found. Finger print assay of these positive clones showed that there were 44/55 clones with full-length insertion (about 700bp) and that these clones had the same fingerprinting. We believe that one clone of phage antibody specific to PreS1 was enriched.
Fig. 1. Specificity of PreS1 binding as revealed by competitive ELISA. Experiments were carried out with the periplasmic fractions from the positive clone, induced with 1 mmol IPTG for 6 h at 30. Apparent affinity was determined as the reciprocal of the PreS1 concentration required to inhibit 50% of maximal binding in a competitive ELISA.

Fig. 2. Nucleotide sequence and aminoacid sequence of the positive clone. CDRs and linker are indicated.
Competitive ELISA
This clone was transformed into E.coli HB-2151 to produce soluble ScFv fragment. Then the specificity was confirmed by competitive ELISA. The result indicated apparent inhibition constant in the range of 10-7-10-8 mol/L (Fig. 1).
Sequence of the specific ScFv
DNAPLOT analysis showed that the sequence of heavy chain belongs to VH4 subgroup and that of light chain belongs to V¦Ë4 subgroup (Fig. 2). GeneBank number is AF422193.
Discussion
Hepatitis B is caused by HBV. Because the disturbance of the immune system, active immunization often does not work well to produce antibody against HBV. As to protective immune response, the late discovery is that immunogenicity is fulfilled through epitope instead of the whole molecule. The immune response[19] elicited by the native antigen molecule can¡¯t satisfy the prevention or protection. Hence research into protective immunization would transfer to epitope.
PreS1 is one of the most important epitope of HBV.[20-22] To obtain the high affinity ScFv against it, the construction immune antibody library is ideal. In other research, sensitized lymphocytes were obtained from normal persons injected with vaccine[23] or from patients.[24] In the former, however, it was difficult to immunize humans because it is rarely possible to ensure the presence of specific B cells at an acceptable frequency in the PBLs[25] and the availability of vaccine also limits its application. In the latter, most of patients especially those infected with HBV were tolerant to the virus, which is meant that the titer of serum antibody is lower than the acceptable level.[26] To overcome these difficulties, the method of in vitro antigen stimulation was employed in this study. Because the peptide PreS1 is too small to induce immune response, it was conjugated with BSA with a high concentration of 100 ¦Ìg/ml. To delete cross reaction of BSA, the rescued phage antibodies were incubated with 3% BSA prior to panning against PreS1. During ELISA, plates were blocked by 2% MPBS to reduce background and false positive.
From the first to the third panning, increasing output clone forming unit (cfu) showed enrichment of specific phages (Table 3). A 100-fold increase in the yield of phage relevant to the first panning also demonstrated accomplishment of the panning. Finally, ScFv specific to PreS1 with affinity of 10-7-10-8 mol/L was confirmed by competitive ELISA. The yield of elute phage was higher than that of other research.[27] This may be due to the in vitro stimulation of antigen. During the procedure, PBLs proliferated twice as compared with the original. It is reasonable to suggest that the genes of lymphocytes rearranged against PreS1.

During construction of the ScFv library, the half-nest PCR was employed because it would optimize the diversity of ScFv gene repertoire, which would also ensure the accomplishment of the panning.
In summary, a sequence encoding the human ScFv against PreS1 of HBV generated would provide a safe method for clinical treatment of patients with hepatitis B virus. Further investigation, however, should be continued including site-directed mutagenesis or mutator strain expression.
Competing interest
No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article.
References
1 Arap W, Pasqualini R, Ruoslahti E. Cancer treatment by targeted drug delivery to tumor vasculaure in a mouse model. Science 1998;279:377-380.
2 Better M, Chang CP, Robinson R, Horwitz AH. Escherichia coli secretion of an active chimeric antibody fragment. Science 1988;240:1041-1043.
3 Winter G, Griffiths AD, Hawkins RE, Hoogenboom HR. Making antibodies by phage display technology. Annu Rev Immunol 1994;12:433-450.
4 de Haard HJ, van Neer N, Reurs A, Hufton SE, Roovers RC, Henderikx P, et al. A large non-immunized human Fab fragment phage library that permits rapid isolation and kinetic analysis of high affinity antibodies. J Biol Chem 1999;274:18218-18230.
5 Tiollais P, Buendia MA. Hepatitis B virus. Sci AM 1991;264:116-123.
6 Passafiume M, Normand BV, Riottot MM. Sequence analysis of a monoclonal antibody specific for the preS2 region of hepatitis B surface antigen, and the cloning, expression and characterization of its single-chain FV construction. FEBS Lett 1998;441:407-412.
7 Lu YY, Li K, Cheng J, Wang L, Liu Y, Zhang LX. Cloning and expression of the PreS1 gene of hepatitis B virus in yeast cells. Hepatobiliary Pancreat Dis Int 2002;1:238-242.
8 Albert A, Gavalletto E, Chemmelo L, Belussi F. Fine specific of human antibody response to the PreS1 during hepatitis B virus. Hepatology 1990;12:199-203.
9 Michel ML, Davis HL, Schleef M, Mancini M, Tiollais P, Whalen RG. DNA-mediated immunization to the hepatitis B surface antigen in mice: aspects of the humoral response mimic hepatitis B viral infection in humans. Proc Natl Acad Sci USA 1995;92:5303-5311.
10 Zhou DY, Lin LY, Wang H, Huang JS. The relationship between HBV lamivudine resistance and HBV genotypes or basic core promoter mutations. Hepatobiliary Pancreat Dis Int 2003;2:85-89.
11 Trope P. Antibody-directed targeting of tumor vasculature. Pro Am Assoc Cancer Res 1996;37:688-671.
12 Coltey M, Jotereau FV, Le Dourarin NM. Evidence for a cyclic renewal of lymphocyte precursor cells in the embryonic chick thymus. Cell Differ 1987;22:71-82.
13 Zhao Y, Zhan M. The coexpression of the PreS1 (1-42) and the core (1-144) antigen of HBV in E. coli. Chin Med Sci J 2002;17:68-72.
14 Schibler U. The synthesis and processing of the mRNAs specifying heavy and light chain immunoglobulins in MPC-11 cells. Cell 1978;15:1495-1504.
15 Wang X, Wang HT, Chen WR, Xu J. Construction of human immunoglobulin combinatorial library and screening of phage antibodies to hepatitis B surface antigen. Sheng Wu Hua Xue Sheng Wu Wu Li Xue Bao 1997;29:183-191.
16 Http://www.mrc-cpe.cam.ac.uk/imt-doc/public/INTRO.html.
17 Marks JD, Hoogenboom HR, Bonnert TP, Mccafferty J, Griffinth AD, Winter G. By-passing immunization human antibodies from V-gene libraries displayed on phage. J Mol Boil 1991;222:581-597.
18 Cao YQ, Qiao SY, Yuan YZ, Huang JS, Zhao SY. Generation of single chain antibody against rP27KIP1 from naive and immune library. Science Chin 1999;29:456-461.
19 Mats AA, Persson MA, Caothien RH, Burton DR. Generation of diverse high-affinity human monoclonal antibodies by repertoire cloning. Proc Natl Acad Sci USA 1991;88:2432-2436.
20 Wu YZ, Liu MC, Jia ZC. The design and synthesis of new HBV antigen. ACTA Acad Medl Mill Tert 2000;22:919-923.
21 Holzer GW, Mayrhofer J, Leitner J, Blum M, Webersinke G, Heuritsch S, et al. Overexpression of hepatitis B virus surface antigens including the PreS1 region in a serum-free Chinese hamster ovary cell line. Protein Expr Purif 2003;29:58-69.
22 Sugauchi F, Ohno T, Orito E, Sakugawa H, Ichida T, Komatsu M, et al. Influence of hepatitis B virus genotypes on the development of preS deletions and advanced liver disease. J Med Virol 2003;70:537-544.
23 Zebedee SL, Barbas CF, Hom YL, Caothien RH, Graff R, DeGraw J, et al. Human combinatorial antibody library to hepatitis B surface antigen. Proc Natl Acad Sci USA 1992;89:3175-3179.
24 Hou YC, Bai XF, Li WS, Li MC, Li GY. Construction of phage display library of hemorrhagic fever patients. Acta J Celet Mole Immune 1997;13:7-11.
25 Zhou DY, Cao YJ, Lin LY, Wang H, Huang JS. HBV resistant to lamivudine: experimental and clinical studies. Hepatobiliary Pancreat Dis Int 2002;1:519-522.
26 Yang DH, Liang WF, Zhao NF, Zhao NF, Fan J. Natural infection of HBV DNA YMDD variant strains in a chronic hepatitis B patient before treatment with lamivudine. Hepatobiliary Pancreat Dis Int 2002;1:539-540.
27 Feng J, Xie Z, Guo N, Shen B. Design and assembly of anti-CD16 ScFv antibody with two different linker peptides. J Immunol Methods 2003;282:33-43.
Received May 19, 2003
Accepted after revision July 7, 2003